1 # fasta34 -Q -H -E 10 -m 9 -b 1 -d 1 -r 15/-10 -g -12 -n -U ../testfiles/NAC_miRNA.fasta ../databases/cotton/CGI8.fasta
2 FASTA searches a protein or DNA sequence data bank
3 version 3.4t25 Sept 2, 2005
5 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
7 Query library ../testfiles/NAC_miRNA.fasta vs ../databases/cotton/CGI8.fasta library
8 searching ../databases/cotton/CGI8.fasta library
10 1>>>total:39860_L:12096_-3:12346_0:617_+3:14801 - 22 nt (forward-only)
11 vs ../databases/cotton/CGI8.fasta library
13 43526801 residues in 55673 sequences
14 Expectation_n fit: rho(ln(x))= 23.6457+/-0.000561; mu= -11.6380+/- 0.037
15 mean_var=607.0983+/-151.124, 0's: 0 Z-trim: 2 B-trim: 0 in 0/43
18 FASTA (3.47 Mar 2004) function [optimized, 15/-10 matrix (15:-10)] ktup: 2
19 join: 213, opt: 198, open/ext: -12/-12, width: 16
21 The best scores are: opt bits E(55673) %_id %_sim bs alen an0 ax0 pn0 px0 an1 ax1 pn1 px1 gapq gapl fs
22 BE054209 similar to PRF|NP_974632.1|42573071|N ( 510) [f] 286 25.6 19 0.762 0.952 286 21 1 21 1 22 471 491 1 510 0 0 0
24 >>>total:39860_L:12096_-3:12346_0:617_+3:14801, 22 nt vs ../databases/cotton/CGI8.fasta library
26 >>BE054209 similar to PRF|NP_974632.1|42573071|NP_974632 pfkB-type carbohydrate kinase family pr (510 nt)
27 initn: 286 init1: 286 opt: 286 Z-score: 111.0 bits: 25.6 E(): 19
28 banded Smith-Waterman score: 286; 76.190% identity (95.238% similar) in 21 nt overlap (1-21:471-491)
31 total: UUGGACAGAGUAAUCACGGUCG
33 BE0542 GAACUNUCUCAGUCAAGUUUAUUAUCUGCAUUGGAUGGAGUAAAUAUGGUCUACUUUGAUGGAAGACAUC
34 450 460 470 480 490 500 510
38 22 residues in 1 query sequences
39 43526801 residues in 55673 library sequences
41 start: Sat Mar 22 16:31:47 2008 done: Sat Mar 22 16:31:49 2008
42 Total Scan time: 2.700 Total Display time: 0.000
44 Function used was FASTA [version 3.4t25 Sept 2, 2005]