1 /usr/local/fasta3/bin/fasta35 -O test_revcomp.fasta35 test_revcomp.fa clusters.fasta
2 FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
4 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
6 Query: ILTV-miR1, 70 nt
7 1>>>ILTV-miR1 - 70 nt - 70 nt
8 Library: clusters.fasta 3924656 residues in 179575 sequences
11 < 20 8261 0:==============================
12 22 16 0:= one = represents 279 library sequences
18 34 4618 2593:=========*=======
19 36 5199 5325:===================*
20 38 7360 8800:=========================== *
21 40 9090 12276:================================= *
22 42 15194 15005:=====================================================*=
23 44 16710 16552:===========================================================*
24 46 14217 16859:=================================================== *
25 48 11294 16141:========================================= *
26 50 13398 14728:================================================= *
27 52 14142 12949:==============================================*====
28 54 10605 11060:=======================================*
29 56 6654 9239:======================== *
30 58 7042 7585:========================== *
31 60 7276 6144:======================*====
32 62 9388 4926:=================*================
33 64 3357 3918:============= *
34 66 3240 3096:===========*
35 68 3655 2435:========*=====
45 88 126 198:* inset = represents 2 library sequences
47 92 79 119:* :=======================================*
48 94 47 92:* :======================== *
49 96 40 71:* :==================== *
50 98 33 55:* :================= *
51 100 24 43:* :============ *
53 104 15 25:* :======== *
61 >120 94 3:* :=*======================================
62 3924656 residues in 179575 sequences
63 Statistics: Expectation_n fit: rho(ln(x))= 6.7921+/-0.000406; mu= 7.9651+/- 0.013
64 mean_var=36.4967+/-12.281, 0's: 2734 Z-trim: 2761 B-trim: 0 in 0/14
66 statistics sampled from 60000 to 179478 sequences
67 Kolmogorov-Smirnov statistic: 0.0718 (N=29) at 58
68 Algorithm: FASTA (3.5 Sept 2006) [optimized]
69 Parameters: +5/-4 matrix (5:-4) ktup: 3
70 join: 60, opt: 45, open/ext: -12/-4, width: 16
72 The best scores are: opt bits E(179572)
73 cluster_79238:1 ( 27) [r] 126 41.0 0.00012
76 >>cluster_79238:1 (27 nt)
77 rev-comp initn: 125 init1: 125 opt: 126 Z-score: 208.3 bits: 41.0 E(): 0.00012
78 banded Smith-Waterman score: 126; 96.3% identity (96.3% similar) in 27 nt overlap (29-3:1-27)
81 ILTV-- TGATTGGGGAATGATTGGGAAGCTTGTGCCAATTCCATTCCTCTTTCTGTCTCCACCGC
82 ::::::::::::::::::::::::: :
83 cluste AATTCCATTCCTCTTTCTGTCTCCAAC
88 70 residues in 1 query sequences
89 3924656 residues in 179575 library sequences
91 start: Tue Oct 27 08:58:20 2009 done: Tue Oct 27 08:58:25 2009
92 Total Scan time: 1.360 Total Display time: 0.000
94 Function used was FASTA [version 35.04 Mar. 26, 2009]