1 # -*-Perl-*- Test Harness script for Bioperl
11 test_begin( -tests => 155 );
13 use_ok('Bio::PrimarySeq');
14 use_ok('Bio::Location::Simple');
15 use_ok('Bio::Location::Fuzzy');
16 use_ok('Bio::Location::Split');
21 ok my $seq = Bio::PrimarySeq->new(), 'Bare object';
22 isa_ok $seq, 'Bio::PrimarySeqI';
26 is $seq->alphabet, undef;
30 ok $seq = Bio::PrimarySeq->new( -seq => '');
33 is $seq->alphabet, undef;
37 ok $seq = Bio::PrimarySeq->new(
38 '-seq' => 'TTGGTGGCGTCAACT',
39 '-display_id' => 'new-id',
41 '-accession_number' => 'X677667',
42 '-desc' => 'Sample Bio::Seq object'
45 is $seq->accession_number(), 'X677667';
46 is $seq->seq(), 'TTGGTGGCGTCAACT';
47 is $seq->display_id(), 'new-id';
48 is $seq->alphabet(), 'dna';
49 is $seq->is_circular(), undef;
50 ok $seq->is_circular(1);
51 is $seq->is_circular(0), 0;
53 # check IdentifiableI and DescribableI interfaces
54 isa_ok $seq, 'Bio::IdentifiableI';
55 isa_ok $seq, 'Bio::DescribableI';
57 # make sure all methods are implemented
58 is $seq->authority("bioperl.org"), "bioperl.org";
59 is $seq->namespace("t"), "t";
60 is $seq->namespace, "t";
61 is $seq->version(0), 0;
62 is $seq->lsid_string(), "bioperl.org:t:X677667";
63 is $seq->namespace_string(), "t:X677667.0";
66 is $seq->namespace_string(), "t:X677667.47";
67 is $seq->description(), 'Sample Bio::Seq object';
68 is $seq->display_name(), "new-id";
70 my $location = Bio::Location::Simple->new(
75 is( $seq->subseq($location), 'ACCA' );
77 my $splitlocation = Bio::Location::Split->new();
78 $splitlocation->add_sub_Location(
79 Bio::Location::Simple->new(
86 $splitlocation->add_sub_Location(
87 Bio::Location::Simple->new(
94 is( $seq->subseq($splitlocation), 'TTGGTGACGC' );
96 my $fuzzy = Bio::Location::Fuzzy->new(
102 is( $seq->subseq($fuzzy), 'GGTGGC' );
104 my $trunc = $seq->trunc( 1, 4 );
105 isa_ok $trunc, 'Bio::PrimarySeqI';
106 is $trunc->seq(), 'TTGG' or diag( "Expecting TTGG. Got " . $trunc->seq() );
108 $trunc = $seq->trunc($splitlocation);
109 isa_ok( $trunc, 'Bio::PrimarySeqI' );
110 is( $trunc->seq(), 'TTGGTGACGC' );
112 $trunc = $seq->trunc($fuzzy);
113 isa_ok( $trunc, 'Bio::PrimarySeqI' );
114 is( $trunc->seq(), 'GGTGGC' );
116 my $rev = $seq->revcom();
117 isa_ok( $rev, 'Bio::PrimarySeqI' );
119 is $rev->seq(), 'AGTTGACGCCACCAA'
120 or diag( 'revcom() failed, was ' . $rev->seq() );
122 is $rev->display_id, 'new-id';
123 is( $rev->alphabet(), 'dna', 'alphabet copied through revcom' );
126 'all attributes of primaryseqs are not currently copied through revcoms';
127 is( $rev->namespace, 't', 'namespace copied through revcom' );
128 is( $rev->namespace_string(),
129 "t:X677667.47", 'namespace_string copied through revcom' );
130 is( $rev->is_circular(), 0, 'is_circular copied through revcom' );
137 my $aa = $seq->translate(); # TTG GTG GCG TCA ACT
138 is $aa->seq, 'LVAST', "Translation: " . $aa->seq;
140 # tests for non-standard initiator codon coding for
141 # M by making translate() look for an initiator codon and
142 # terminator codon ("complete", the 5th argument below)
143 $seq->seq('TTGGTGGCGTCAACTTAA'); # TTG GTG GCG TCA ACT TAA
144 $aa = $seq->translate( undef, undef, undef, undef, 1 );
145 is $aa->seq, 'MVAST', "Translation: " . $aa->seq;
147 # same test as previous, but using named parameter
148 $aa = $seq->translate( -complete => 1 );
149 is $aa->seq, 'MVAST', "Translation: " . $aa->seq;
151 # find ORF, ignore codons outside the ORF or CDS
152 $seq->seq('TTTTATGGTGGCGTCAACTTAATTT'); # ATG GTG GCG TCA ACT
153 $aa = $seq->translate( -orf => 1 );
154 is $aa->seq, 'MVAST*', "Translation: " . $aa->seq;
156 # smallest possible ORF
157 $seq->seq("ggggggatgtagcccc"); # atg tga
158 $aa = $seq->translate( -orf => 1 );
159 is $aa->seq, 'M*', "Translation: " . $aa->seq;
161 # same as previous but complete, so * is removed
162 $aa = $seq->translate(
166 is $aa->seq, 'M', "Translation: " . $aa->seq;
168 # ORF without termination codon
169 # should warn, let's change it into throw for testing
171 $seq->seq("ggggggatgtggcccc"); # atg tgg ccc
172 eval { $seq->translate( -orf => 1 ); };
173 like( $@, qr/\batgtggccc\b/i );
175 $aa = $seq->translate( -orf => 1 );
176 is $aa->seq, 'MWP', "Translation: MWP";
179 # use non-standard codon table where terminator is read as Q
180 $seq->seq('ATGGTGGCGTCAACTTAG'); # ATG GTG GCG TCA ACT TAG
181 $aa = $seq->translate( -codontable_id => 6 );
182 is $aa->seq, 'MVASTQ' or diag( "Translation: " . $aa->seq );
184 # insert an odd character instead of terminating with *
185 $aa = $seq->translate( -terminator => 'X' );
186 is $aa->seq, 'MVASTX' or diag( "Translation: " . $aa->seq );
188 # change frame from default
189 $aa = $seq->translate( -frame => 1 ); # TGG TGG CGT CAA CTT AG
190 is $aa->seq, 'WWRQL' or diag( "Translation: " . $aa->seq );
192 $aa = $seq->translate( -frame => 2 ); # GGT GGC GTC AAC TTA G
193 is $aa->seq, 'GGVNL' or diag( "Translation: " . $aa->seq );
195 # TTG is initiator in Standard codon table? Afraid so.
196 $seq->seq("ggggggttgtagcccc"); # ttg tag
197 $aa = $seq->translate( -orf => 1 );
198 is $aa->seq, 'L*' or diag( "Translation: " . $aa->seq );
200 # Replace L at 1st position with M by setting complete to 1
201 $seq->seq("ggggggttgtagcccc"); # ttg tag
202 $aa = $seq->translate(
206 is $aa->seq, 'M' or diag( "Translation: " . $aa->seq );
208 # Ignore non-ATG initiators (e.g. TTG) in codon table
209 $seq->seq("ggggggttgatgtagcccc"); # atg tag
210 $aa = $seq->translate(
215 is $aa->seq, 'M' or diag( "Translation: " . $aa->seq );
217 # test for character '?' in the sequence string
218 is $seq->seq('TTGGTGGCG?CAACT'), 'TTGGTGGCG?CAACT';
220 # test for some aliases
221 $seq = Bio::PrimarySeq->new(
223 -description => 'Alias desc'
225 is( $seq->description, 'Alias desc' );
226 is( $seq->display_id, 'aliasid' );
230 ok $seq->seq('actgx');
231 is $seq->alphabet, 'protein', 'Alphabet';
232 ok $seq->seq('actge');
233 is $seq->alphabet, 'protein';
234 ok $seq->seq('actgf');
235 is $seq->alphabet, 'protein';
236 ok $seq->seq('actgi');
237 is $seq->alphabet, 'protein';
238 ok $seq->seq('actgj');
239 is $seq->alphabet, 'protein';
240 ok $seq->seq('actgl');
241 is $seq->alphabet, 'protein';
242 ok $seq->seq('actgo');
243 is $seq->alphabet, 'protein';
244 ok $seq->seq('actgp');
245 is $seq->alphabet, 'protein';
246 ok $seq->seq('actgq');
247 is $seq->alphabet, 'protein';
248 ok $seq->seq('actgz');
249 is $seq->alphabet, 'protein';
250 ok $seq->seq('actgn');
251 is $seq->alphabet, 'dna';
252 ok $seq->seq('acugn');
253 is $seq->alphabet, 'rna';
254 ok $seq->seq('bdhkm');
255 is $seq->alphabet, 'protein';
256 ok $seq->seq('rsvwx');
257 is $seq->alphabet, 'protein';
258 ok $seq->seq('AAACTYAAAAGAATTGRCGG'); # valid degenerate DNA PCR primer sequence (90% ACGTN)
259 is $seq->alphabet, 'dna';
260 ok $seq->seq('AAACTYAAAKGAATTGRCGG'); # another primer previously detected as protein (85% ACGTN)
261 is $seq->alphabet, 'dna';
262 ok $seq->seq('YWACTYAAAKGARTTGRCGG'); # 70% ACGTN. Everything <= 70% is considered a protein
263 is $seq->alphabet, 'protein';
264 ok $seq->seq('XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX'); # Bug 2438
265 is $seq->alphabet, 'protein', 'Bug 2438';
266 ok $seq->seq('CAGTCXXXXXXXXXXXXXXXXXXXXXXXXXXXCAGCG');
267 is $seq->alphabet, 'protein';
269 ok $seq->seq('actgn', 'protein'); # accept specified alphabet, no matter what
270 is $seq->alphabet, 'protein';
271 ok $seq->seq('bdhkm', 'dna');
272 is $seq->alphabet, 'dna';
277 $seq = Bio::PrimarySeq->new( -display_id => 0, -seq => 'GATC' );
279 is $seq->display_id, 0, "Bug #2864";
281 # Test that the check for terminators inside the translated protein
282 # works when the terminator isn't '*':
284 $seq = Bio::PrimarySeq->new(-seq=>'ATGCTCTAAGCAGGGTAA'); # ML*AG*
285 eval { $aa = $seq->translate(-complete=>1, -throw=>1, -terminator=>'#') };
287 ok $error =~ /\QTerminator codon inside CDS!\E/, 'Terminator + inside sequence';
289 $seq = Bio::PrimarySeq->new(-seq=>'ATGCTCGCAGGGTAA'); # MLAG*
290 $aa = $seq->translate(-complete=>1, -throw=>1, -terminator=>'#');
295 ok $seq = Bio::PrimarySeq->new(), 'Length method';
297 ok $seq->length(123);
298 is $seq->length, 123;
300 ok $seq = Bio::PrimarySeq->new( -seq => 'ATGCTCTAAGCAGGGTAA' );
302 ok $seq->seq('ATGCTCTAAG');
304 is $seq->seq(undef), undef;
307 ok $seq = Bio::PrimarySeq->new( -length => 123 );
308 is $seq->length, 123;
310 ok $seq = Bio::PrimarySeq->new( -seq => 'ATGCTCTAAGCAGGGTAA' );
312 ok $seq->length( $seq->length ); # save memory by removing seq
313 is $seq->seq( undef ), undef; # ... but keeping a record of length
316 ok $seq->seq('ACGT');
317 is $seq->length, 4; # manually-specified length changed when sequence is changed
319 throws_ok { $seq->length(666); } qr/.+/; # Cannot lie about length
322 # Sequence validation method
323 is $seq->validate_seq( undef ), 1;
324 is $seq->validate_seq( '' ), 1;
325 is $seq->validate_seq( 'acgt' ), 1;
326 is $seq->validate_seq( 'ACGT' ), 1;
327 is $seq->validate_seq( 'XFRH' ), 1;
328 is $seq->validate_seq( '-~' ), 1; # gap symbols
329 is $seq->validate_seq( '-.*?=~' ), 1; # other valid symbols
330 is $seq->validate_seq( 'AAAA$' ), 0;
331 is $seq->validate_seq( 'tt&tt' ), 0;
334 # Test direct option (no sequence validation)
335 throws_ok { $seq = Bio::PrimarySeq->new(-seq => 'A\T$AGQ+T'); } qr/.+/, 'Validation';
336 ok $seq = Bio::PrimarySeq->new( -seq => 'A\T$AGQ+T', -direct => 1 );
337 is $seq->seq, 'A\T$AGQ+T';
340 # Set a sequence by reference
341 my $string = 'AAAACCCCGGGGTTTT';
342 ok $seq = Bio::PrimarySeq->new( -ref_to_seq => \$string );
343 is $seq->seq, 'AAAACCCCGGGGTTTT';
346 # Test internal PrimarySeqI _find_orfs function and translate( -orf => 'longest' )
350 ['TTTTATGGTGGCGTCAACTTAATTT',
354 #bigger test (this is a tomato unigene)
355 ['GAAGGCTGGTTCTGAGTTGGATCTATGTTTGATGAAGGGAAGTAGACCGGAGGTCTTGCATCAGCAATATTAGTACCAAATCCAGGTGGAGGCGCATCCTGTCTCCGTTGCATTTCAACTTTCATTTCAGCAATCTGTTGCATCAGTTGCATGATCAATTCATTCTGTTCCACTACAGTGGGCTGAGCGACCACAACGTCAGTAAGACGCCCTTCGTCATTGTTGTCTCCCATAACTGTTTTTCCTTTATCTGAATTTGATCGAGGGAAGGAATCTGTAGGACCTTTCGATCTGGTGAAGTAAGGATGATCTGCCAGCTTTATTGACACAGATCAGTAAAAAGGTACCTGAAAGGTAAAAACAACTCAAAGGCAAATTTGTTAGTGCATATCCAGAGTACAAAATGCTTAATATCGCACATAAAACCGATAAACACACAAGTCGTTTTGTTTGAGGATATCTTAACCCACGAATAAGGACGGATATATATTTTGAACAAACAGGAATTTGTTTGTTTGGCGTTATCTTGGGAAATCTG',
356 [[98,254,156,2],[347,476,129,2],[219,303,84,0],[16,73,57,1],[403,454,51,1],[310,358,48,1],[235,280,45,1],[491,536,45,2],[150,186,36,0],[507,537,30,0],[5,32,27,2],[511,538,27,1],[24,45,21,0],[305,326,21,2],[450,465,15,0]],
361 foreach my $test (@tests) {
362 my ($test_seq, $orfs) = @$test;
363 my @orfs = Bio::PrimarySeqI::_find_orfs_nucleotide(
366 Bio::Tools::CodonTable->new,
368 ); # ATG GTG GCG TCA ACT
369 is_deeply( \@orfs, $orfs, '_find_orfs 1')
370 or diag "for $test_seq, _find_orfs returned:\n"
371 .Dumper([map [@$_], @orfs]);
373 is_deeply( $orfs->[0],
374 (sort {$b->[2] <=> $a->[2]} @$orfs)[0],
375 'orfs are sorted by descending length'
378 # make sure we get the same sequence by taking the longest orf
379 # nucleotide from the test data and translating it, as by
380 # calling translate with -orf => 'longest'
383 ->new( -seq => $test_seq, -id => 'fake_id' )
384 ->translate( -orf => 'longest' )
388 ->new( -seq => substr( $test_seq, $orfs->[0][0], $orfs->[0][2] ),
393 'got correct -orf => "longest" seq',