1 # -*-Perl-*- Test Harness script for Bioperl
10 test_begin( -tests => 310 );
12 use_ok('Bio::PrimarySeq');
13 use_ok('Bio::Location::Simple');
14 use_ok('Bio::Location::Fuzzy');
15 use_ok('Bio::Location::Split');
20 ok my $seq = Bio::PrimarySeq->new(), 'Bare object';
21 isa_ok $seq, 'Bio::PrimarySeqI';
25 is $seq->alphabet, undef;
26 is $seq->is_circular, undef;
30 ok $seq = Bio::PrimarySeq->new( -seq => '', -nowarnonempty => 1);
33 is $seq->alphabet, undef;
37 ok $seq = Bio::PrimarySeq->new(
38 '-seq' => 'TTGGTGGCGTCAACT',
39 '-display_id' => 'new-id',
41 '-accession_number' => 'X677667',
42 '-desc' => 'Sample Bio::Seq object'
45 is $seq->accession_number(), 'X677667';
46 is $seq->seq(), 'TTGGTGGCGTCAACT';
47 is $seq->display_id(), 'new-id';
48 is $seq->alphabet(), 'dna';
49 is $seq->is_circular(), undef;
50 ok $seq->is_circular(1);
51 is $seq->is_circular(0), 0;
53 # check IdentifiableI and DescribableI interfaces
54 isa_ok $seq, 'Bio::IdentifiableI';
55 isa_ok $seq, 'Bio::DescribableI';
57 # make sure all methods are implemented
58 is $seq->authority("bioperl.org"), "bioperl.org";
59 is $seq->authority, "bioperl.org";
60 is $seq->namespace("t"), "t";
61 is $seq->namespace, "t";
62 is $seq->version(0), 0;
64 is $seq->lsid_string(), "bioperl.org:t:X677667";
65 is $seq->namespace_string, "t:X677667.0";
66 is $seq->version(47), 47;
68 is $seq->namespace_string, "t:X677667.47";
69 is $seq->description, 'Sample Bio::Seq object';
70 is $seq->display_name, "new-id";
74 is $seq->subseq(2, 5), 'TGGT';
76 is $seq->subseq( -start => 1, -end => 15), 'TTGGTGGCGTCAACT';
78 my $location = Bio::Location::Simple->new(
83 is $seq->subseq($location), 'ACCA';
85 my $splitlocation = Bio::Location::Split->new();
86 $splitlocation->add_sub_Location(
87 Bio::Location::Simple->new(
94 $splitlocation->add_sub_Location(
95 Bio::Location::Simple->new(
102 is $seq->subseq($splitlocation), 'TTGGTGACGC';
104 my $fuzzy = Bio::Location::Fuzzy->new(
110 is $seq->subseq($fuzzy), 'GGTGGC';
113 ok my $seq = Bio::PrimarySeq->new( -seq => 'TT-GTGGCGTCAACT' );
114 is $seq->subseq(2, 5, 'nogap'), 'TGT';
115 is $seq->subseq( -start => 2, -end => 5, -nogap => 1 ), 'TGT';
116 my $location = Bio::Location::Simple->new(
121 is $seq->subseq( $location, -nogap => 1), 'TGT';
123 is $seq->subseq(-start=>2, -end=>5, -replace_with=>'aa'), 'T-GT';
124 is $seq->seq, 'TaaGGCGTCAACT';
126 throws_ok { $seq->subseq(-start=>2, -end=>5, -replace_with=>'?!'); } qr/.+/;
130 ok my $seq = Bio::PrimarySeq->new( -seq => 'AACCGGTT', -is_circular => 1 );
131 is $seq->subseq( -start => 7, -end => 10 ), 'TTAA';
134 ### Test for Bug #2936
135 # Without strand input argument (case: user don't think is necessary)
136 my $split_loc_obj1 = Bio::Location::Split->new();
137 $split_loc_obj1->add_sub_Location(
138 Bio::Location::Simple->new(
143 $split_loc_obj1->add_sub_Location(
144 Bio::Location::Simple->new(
149 # With strand input argument (case: user provides the argument)
150 my $split_loc_obj2 = Bio::Location::Split->new();
151 $split_loc_obj2->add_sub_Location(
152 Bio::Location::Simple->new(
158 $split_loc_obj2->add_sub_Location(
159 Bio::Location::Simple->new(
165 is $split_loc_obj1->to_FTstring, "join(1..10,20..30)";
166 is $split_loc_obj2->to_FTstring, "join(1..10,20..30)";
167 $split_loc_obj1->flip_strand;
168 $split_loc_obj2->flip_strand;
169 is $split_loc_obj1->to_FTstring, "complement(join(1..10,20..30))";
170 is $split_loc_obj2->to_FTstring, "complement(join(1..10,20..30))";
174 my $trunc = $seq->trunc( 1, 4 );
175 isa_ok $trunc, 'Bio::PrimarySeqI';
176 is $trunc->seq(), 'TTGG' or diag( "Expecting TTGG. Got " . $trunc->seq() );
178 $trunc = $seq->trunc($splitlocation);
179 isa_ok $trunc, 'Bio::PrimarySeqI' ;
180 is $trunc->seq(), 'TTGGTGACGC';
182 $trunc = $seq->trunc($fuzzy);
183 isa_ok $trunc, 'Bio::PrimarySeqI';
184 is $trunc->seq(), 'GGTGGC';
186 my $rev = $seq->revcom();
187 isa_ok $rev, 'Bio::PrimarySeqI';
189 is $rev->seq(), 'AGTTGACGCCACCAA'
190 or diag( 'revcom() failed, was ' . $rev->seq() );
192 is $rev->display_id, 'new-id';
193 is $rev->display_name(), 'new-id';
194 is $rev->accession_number(), 'X677667';
195 is $rev->alphabet, 'dna';
196 is $rev->description, 'Sample Bio::Seq object';
197 is $rev->is_circular(), 0;
198 is $rev->version, 47;
199 is $rev->authority, 'bioperl.org';
200 is $rev->namespace, 't';
201 is $rev->namespace_string(), 't:X677667.47';
207 my $aa = $seq->translate(); # TTG GTG GCG TCA ACT
208 is $aa->seq, 'LVAST', "Translation: " . $aa->seq;
210 # tests for non-standard initiator codon coding for
211 # M by making translate() look for an initiator codon and
212 # terminator codon ("complete", the 5th argument below)
213 $seq->seq('TTGGTGGCGTCAACTTAA'); # TTG GTG GCG TCA ACT TAA
214 $aa = $seq->translate( undef, undef, undef, undef, 1 );
215 is $aa->seq, 'MVAST', "Translation: " . $aa->seq;
217 # same test as previous, but using named parameter
218 $aa = $seq->translate( -complete => 1 );
219 is $aa->seq, 'MVAST', "Translation: " . $aa->seq;
221 # find ORF, ignore codons outside the ORF or CDS
222 $seq->seq('TTTTATGGTGGCGTCAACTTAATTT'); # ATG GTG GCG TCA ACT
223 $aa = $seq->translate( -orf => 1 );
224 is $aa->seq, 'MVAST*', "Translation: " . $aa->seq;
226 # smallest possible ORF
227 $seq->seq("ggggggatgtagcccc"); # atg tga
228 $aa = $seq->translate( -orf => 1 );
229 is $aa->seq, 'M*', "Translation: " . $aa->seq;
231 # same as previous but complete, so * is removed
232 $aa = $seq->translate(
236 is $aa->seq, 'M', "Translation: " . $aa->seq;
238 # ORF without termination codon
239 # should warn, let's change it into throw for testing
241 $seq->seq("ggggggatgtggcccc"); # atg tgg ccc
242 eval { $seq->translate( -orf => 1 ); };
243 like( $@, qr/\batgtggccc\b/i );
245 $aa = $seq->translate( -orf => 1 );
246 is $aa->seq, 'MWP', "Translation: MWP";
249 # use non-standard codon table where terminator is read as Q
250 $seq->seq('ATGGTGGCGTCAACTTAG'); # ATG GTG GCG TCA ACT TAG
251 $aa = $seq->translate( -codontable_id => 6 );
252 is $aa->seq, 'MVASTQ' or diag( "Translation: " . $aa->seq );
254 # insert an odd character instead of terminating with *
255 $aa = $seq->translate( -terminator => 'X' );
256 is $aa->seq, 'MVASTX' or diag( "Translation: " . $aa->seq );
258 # change frame from default
259 $aa = $seq->translate( -frame => 1 ); # TGG TGG CGT CAA CTT AG
260 is $aa->seq, 'WWRQL' or diag( "Translation: " . $aa->seq );
262 $aa = $seq->translate( -frame => 2 ); # GGT GGC GTC AAC TTA G
263 is $aa->seq, 'GGVNL' or diag( "Translation: " . $aa->seq );
265 # TTG is initiator in Standard codon table? Afraid so.
266 $seq->seq("ggggggttgtagcccc"); # ttg tag
267 $aa = $seq->translate( -orf => 1 );
268 is $aa->seq, 'L*' or diag( "Translation: " . $aa->seq );
270 # Replace L at 1st position with M by setting complete to 1
271 $seq->seq("ggggggttgtagcccc"); # ttg tag
272 $aa = $seq->translate(
276 is $aa->seq, 'M' or diag( "Translation: " . $aa->seq );
278 # Ignore non-ATG initiators (e.g. TTG) in codon table
279 $seq->seq("ggggggttgatgtagcccc"); # atg tag
280 $aa = $seq->translate(
285 is $aa->seq, 'M' or diag( "Translation: " . $aa->seq );
287 # test for character '?' in the sequence string
288 is $seq->seq('TTGGTGGCG?CAACT'), 'TTGGTGGCG?CAACT';
290 # test for some aliases
291 $seq = Bio::PrimarySeq->new(
293 -description => 'Alias desc'
295 is $seq->description, 'Alias desc';
296 is $seq->display_id, 'aliasid';
300 ok $seq->seq('actgx');
301 is $seq->alphabet, 'protein', 'Alphabet';
302 ok $seq->seq('actge');
303 is $seq->alphabet, 'protein';
304 ok $seq->seq('actgf');
305 is $seq->alphabet, 'protein';
306 ok $seq->seq('actgi');
307 is $seq->alphabet, 'protein';
308 ok $seq->seq('actgj');
309 is $seq->alphabet, 'protein';
310 ok $seq->seq('actgl');
311 is $seq->alphabet, 'protein';
312 ok $seq->seq('actgo');
313 is $seq->alphabet, 'protein';
314 ok $seq->seq('actgp');
315 is $seq->alphabet, 'protein';
316 ok $seq->seq('actgq');
317 is $seq->alphabet, 'protein';
318 ok $seq->seq('actgz');
319 is $seq->alphabet, 'protein';
320 ok $seq->seq('actgn');
321 is $seq->alphabet, 'dna';
322 ok $seq->seq('acugn');
323 is $seq->alphabet, 'rna';
324 ok $seq->seq('bdhkm');
325 is $seq->alphabet, 'protein';
326 ok $seq->seq('rsvwx');
327 is $seq->alphabet, 'protein';
328 ok $seq->seq('AAACTYAAAAGAATTGRCGG'); # valid degenerate DNA PCR primer sequence (90% ACGTN)
329 is $seq->alphabet, 'dna';
330 ok $seq->seq('AAACTYAAAKGAATTGRCGG'); # another primer previously detected as protein (85% ACGTN)
331 is $seq->alphabet, 'dna';
332 ok $seq->seq('YWACTYAAAKGARTTGRCGG'); # 70% ACGTNWSRM. Everything <= 70% is considered a protein
333 is $seq->alphabet, 'dna';
334 ok $seq->seq('XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX'); # Bug 2438
335 is $seq->alphabet, 'protein', 'Bug 2438';
336 ok $seq->seq('CAGTCXXXXXXXXXXXXXXXXXXXXXXXXXXXCAGCG');
337 is $seq->alphabet, 'protein';
338 ok $seq->seq('WTGGGGCTATGAAAAAAAAAWTTKMGMMAAAAAWTTWTKRWMRATC'); # showed up on MAKER list
339 is $seq->alphabet, 'dna';
341 ok $seq->seq('actgn', 'protein'); # accept specified alphabet, no matter what
342 is $seq->alphabet, 'protein';
343 ok $seq->seq('bdhkm', 'dna');
344 is $seq->alphabet, 'dna';
349 $seq = Bio::PrimarySeq->new( -display_id => 0, -seq => 'GATC' );
351 is $seq->display_id, 0, "Bug #2864";
353 # Test that the check for terminators inside the translated protein
354 # works when the terminator isn't '*':
356 $seq = Bio::PrimarySeq->new(-seq=>'ATGCTCTAAGCAGGGTAA'); # ML*AG*
357 eval { $aa = $seq->translate(-complete=>1, -throw=>1, -terminator=>'#') };
359 ok $error =~ /\QTerminator codon inside CDS!\E/, 'Terminator + inside sequence';
361 $seq = Bio::PrimarySeq->new(-seq=>'ATGCTCGCAGGGTAA'); # MLAG*
362 $aa = $seq->translate(-complete=>1, -throw=>1, -terminator=>'#');
367 ok $seq = Bio::PrimarySeq->new(), 'Length method';
369 ok $seq->length(123);
370 is $seq->length, 123;
372 ok $seq = Bio::PrimarySeq->new( -seq => 'ATGCTCTAAGCAGGGTAA' );
374 ok $seq->seq('ATGCTCTAAG');
376 is $seq->seq(undef), undef;
379 ok $seq = Bio::PrimarySeq->new( -length => 123 );
380 is $seq->length, 123;
382 ok $seq = Bio::PrimarySeq->new( -seq => 'ATGCTCTAAGCAGGGTAA' );
384 ok $seq->length( $seq->length ); # save memory by removing seq
385 is $seq->seq( undef ), undef; # ... but keeping a record of length
388 ok $seq->seq('ACGT');
389 is $seq->length, 4; # manually-specified length changed when sequence is changed
391 throws_ok { $seq->length(666); } qr/.+/; # Cannot lie about length
394 # Sequence validation method
395 is $seq->validate_seq( undef ), 1;
396 is $seq->validate_seq( '' ), 1;
397 is $seq->validate_seq( 'acgt' ), 1;
398 is $seq->validate_seq( 'ACGT' ), 1;
399 is $seq->validate_seq( 'XFRH' ), 1;
400 is $seq->validate_seq( '-~' ), 1; # gap symbols
401 is $seq->validate_seq( '-.*?=~' ), 1; # other valid symbols
402 is $seq->validate_seq( '0' ), 0;
403 is $seq->validate_seq( ' ' ), 0;
404 is $seq->validate_seq( 'AAAA$' ), 0;
405 is $seq->validate_seq( 'tt&t!' ), 0;
407 throws_ok { $seq->validate_seq('tt&t!', 1); } qr/.+/;
410 # Test direct option (no sequence validation)
411 throws_ok { $seq = Bio::PrimarySeq->new(-seq => 'A\T$AGQ+T'); } qr/.+/, 'Validation';
412 ok $seq = Bio::PrimarySeq->new( -seq => 'A\T$AGQ+T', -direct => 1 );
413 is $seq->seq, 'A\T$AGQ+T';
414 throws_ok { $seq->seq('NT@/') } qr/.+/;
416 # Set a sequence by reference
417 my $string = 'AAAACCCCGGGGTTTT';
418 ok $seq = Bio::PrimarySeq->new( -ref_to_seq => \$string );
419 is $seq->seq, 'AAAACCCCGGGGTTTT';
422 # Test internal PrimarySeqI _find_orfs function and translate( -orf => 'longest' )
426 ['TTTTATGGTGGCGTCAACTTAATTT',
430 #bigger test (this is a tomato unigene)
431 ['GAAGGCTGGTTCTGAGTTGGATCTATGTTTGATGAAGGGAAGTAGACCGGAGGTCTTGCATCAGCAATATTAGTACCAAATCCAGGTGGAGGCGCATCCTGTCTCCGTTGCATTTCAACTTTCATTTCAGCAATCTGTTGCATCAGTTGCATGATCAATTCATTCTGTTCCACTACAGTGGGCTGAGCGACCACAACGTCAGTAAGACGCCCTTCGTCATTGTTGTCTCCCATAACTGTTTTTCCTTTATCTGAATTTGATCGAGGGAAGGAATCTGTAGGACCTTTCGATCTGGTGAAGTAAGGATGATCTGCCAGCTTTATTGACACAGATCAGTAAAAAGGTACCTGAAAGGTAAAAACAACTCAAAGGCAAATTTGTTAGTGCATATCCAGAGTACAAAATGCTTAATATCGCACATAAAACCGATAAACACACAAGTCGTTTTGTTTGAGGATATCTTAACCCACGAATAAGGACGGATATATATTTTGAACAAACAGGAATTTGTTTGTTTGGCGTTATCTTGGGAAATCTG',
432 [[98,254,156,2],[347,476,129,2],[219,303,84,0],[16,73,57,1],[403,454,51,1],[310,358,48,1],[235,280,45,1],[491,536,45,2],[150,186,36,0],[507,537,30,0],[5,32,27,2],[511,538,27,1],[24,45,21,0],[305,326,21,2],[450,465,15,0]],
437 foreach my $test (@tests) {
438 my ($test_seq, $orfs) = @$test;
439 my @orfs = Bio::PrimarySeqI::_find_orfs_nucleotide(
442 Bio::Tools::CodonTable->new,
444 ); # ATG GTG GCG TCA ACT
445 is_deeply( \@orfs, $orfs, '_find_orfs 1')
446 or diag "for $test_seq, _find_orfs returned:\n"
447 .Dumper([map [@$_], @orfs]);
449 is_deeply( $orfs->[0],
450 (sort {$b->[2] <=> $a->[2]} @$orfs)[0],
451 'orfs are sorted by descending length'
454 # make sure we get the same sequence by taking the longest orf
455 # nucleotide from the test data and translating it, as by
456 # calling translate with -orf => 'longest'
459 ->new( -seq => $test_seq, -id => 'fake_id' )
460 ->translate( -orf => 'longest' )
464 ->new( -seq => substr( $test_seq, $orfs->[0][0], $orfs->[0][2] ),
469 'got correct -orf => "longest" seq',
475 # Extensive location and subsequence tests
476 ok $seq = Bio::PrimarySeq->new('-seq' => 'AAAAACCCCCGGGGGTTTTT',);
477 ok $seq->is_circular(1);
479 # NOTE: "_no_strand" variables tests the possibility that the user didn't set
480 # Strand for positive coordinates (or the object comes from
481 # Bio::Factory::FTLocationFactory->from_string)
484 # Coordinates: 1..5 => AAAAA
485 # Revcom: complement(1..5) => TTTTT
486 ok my $loc1_strand = Bio::Location::Simple->new('-start' => 1, '-end' => 5,'-strand' => 1);
487 ok my $loc1_no_strand = Bio::Location::Simple->new('-start' => 1, '-end' => 5);
488 is $seq->subseq($loc1_strand), 'AAAAA';
489 is $seq->subseq($loc1_no_strand), 'AAAAA';
490 is $loc1_strand->to_FTstring, '1..5';
491 is $loc1_no_strand->to_FTstring, '1..5';
492 $loc1_strand->flip_strand;
493 $loc1_no_strand->flip_strand;
494 is $seq->subseq($loc1_strand), 'TTTTT';
495 is $seq->subseq($loc1_no_strand), 'TTTTT';
496 is $loc1_strand->to_FTstring, 'complement(1..5)';
497 is $loc1_no_strand->to_FTstring, 'complement(1..5)';
498 is $loc1_strand->length, 5;
499 is $loc1_no_strand->length, 5;
501 # Basic split, both locations in positive strand
502 # Coords: join(6..10,16..20) => CCCCCTTTTT
503 # Revcom: complement(join(6..10,16..20)) => AAAAAGGGGG
504 ok my $loc2_strand = Bio::Location::Split->new();
505 ok my $loc2_no_strand = Bio::Location::Split->new();
506 ok $loc2_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => 1) );
507 ok $loc2_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20, '-strand' => 1) );
508 ok $loc2_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10) );
509 ok $loc2_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20) );
510 is $seq->subseq($loc2_strand), 'CCCCCTTTTT';
511 is $seq->subseq($loc2_no_strand), 'CCCCCTTTTT';
512 is $loc2_strand->to_FTstring, 'join(6..10,16..20)';
513 is $loc2_no_strand->to_FTstring, 'join(6..10,16..20)';
514 $loc2_strand->flip_strand;
515 $loc2_no_strand->flip_strand;
516 is $seq->subseq($loc2_strand), 'AAAAAGGGGG';
517 is $seq->subseq($loc2_no_strand), 'AAAAAGGGGG';
518 is $loc2_strand->to_FTstring, 'complement(join(6..10,16..20))';
519 is $loc2_no_strand->to_FTstring, 'complement(join(6..10,16..20))';
520 is $loc2_strand->length, 15;
521 is $loc2_no_strand->length, 15;
523 # Basic split, both locations in negative strand
524 # Coords: complement(join(6..10,16..20)) => AAAAAGGGGG
525 # Revcom: join(6..10,16..20) => CCCCCTTTTT
526 my $loc3_strand = Bio::Location::Split->new();
527 $loc3_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => -1) );
528 $loc3_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20, '-strand' => -1) );
529 is $seq->subseq($loc3_strand), 'AAAAAGGGGG';
530 is $loc3_strand->to_FTstring, 'complement(join(6..10,16..20))';
531 $loc3_strand->flip_strand;
532 is $seq->subseq($loc3_strand), 'CCCCCTTTTT';
533 is $loc3_strand->to_FTstring, 'join(6..10,16..20)';
534 is $loc3_strand->length, 15;
536 ## Cut by origin-split, same strand, single sequence that pass through origin
537 #Coords: join(16..20,1..2) => TTTTTAA
538 #Revcom: complement(join(16..20,1..2)) => TTAAAAA
539 my $loc4_strand = Bio::Location::Split->new();
540 my $loc4_no_strand = Bio::Location::Split->new();
541 $loc4_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20, '-strand' => 1) );
542 $loc4_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2, '-strand' => 1) );
543 $loc4_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20) );
544 $loc4_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2) );
545 is $seq->subseq($loc4_strand), 'TTTTTAA';
546 is $seq->subseq($loc4_no_strand), 'TTTTTAA';
547 is $loc4_strand->to_FTstring, 'join(16..20,1..2)';
548 is $loc4_no_strand->to_FTstring, 'join(16..20,1..2)';
549 $loc4_strand->flip_strand;
550 $loc4_no_strand->flip_strand;
551 is $seq->subseq($loc4_strand), 'TTAAAAA';
552 is $seq->subseq($loc4_no_strand), 'TTAAAAA';
553 is $loc4_strand->to_FTstring, 'complement(join(16..20,1..2))';
554 is $loc4_no_strand->to_FTstring, 'complement(join(16..20,1..2))';
555 is $loc4_strand->length, 7;
556 is $loc4_no_strand->length, 7;
558 ## Cut by origin-combo split, same strand, 2 sequences with 1st passing through origin
559 #Coords: join(19..20,1..2,11..13) => TTAAGGG
560 #Revcom: complement(join(19..20,1..2,11..13)) => CCCTTAA
561 my $loc5_strand = Bio::Location::Split->new();
562 my $loc5_no_strand = Bio::Location::Split->new();
563 $loc5_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20, '-strand' => 1) );
564 $loc5_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2, '-strand' => 1) );
565 $loc5_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 11, '-end' => 13, '-strand' => 1) );
566 $loc5_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20) );
567 $loc5_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2) );
568 $loc5_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 11, '-end' => 13) );
569 is $seq->subseq($loc5_strand), 'TTAAGGG';
570 is $seq->subseq($loc5_no_strand), 'TTAAGGG';
571 is $loc5_strand->to_FTstring, 'join(19..20,1..2,11..13)';
572 is $loc5_no_strand->to_FTstring, 'join(19..20,1..2,11..13)';
573 $loc5_strand->flip_strand;
574 $loc5_no_strand->flip_strand;
575 is $seq->subseq($loc5_strand), 'CCCTTAA';
576 is $seq->subseq($loc5_no_strand), 'CCCTTAA';
577 is $loc5_strand->to_FTstring, 'complement(join(19..20,1..2,11..13))';
578 is $loc5_no_strand->to_FTstring, 'complement(join(19..20,1..2,11..13))';
579 is $loc5_strand->length, 15;
580 is $loc5_no_strand->length, 15;
582 ## Cut by origin-combo split, same strand, 2 sequences with 2nd passing through origin
583 #Coords: join(6..10,19..20,1..4) => CCCCCTTAAAA
584 #Revcom: complement(join(6..10,19..20,1..4)) => TTTTAAGGGGG
585 my $loc6_strand = Bio::Location::Split->new();
586 my $loc6_no_strand = Bio::Location::Split->new();
587 $loc6_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => 1) );
588 $loc6_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20, '-strand' => 1) );
589 $loc6_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 4, '-strand' => 1) );
590 $loc6_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10) );
591 $loc6_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20) );
592 $loc6_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 4) );
593 is $seq->subseq($loc6_strand), 'CCCCCTTAAAA';
594 is $seq->subseq($loc6_no_strand), 'CCCCCTTAAAA';
595 is $loc6_strand->to_FTstring, 'join(6..10,19..20,1..4)';
596 is $loc6_no_strand->to_FTstring, 'join(6..10,19..20,1..4)';
597 $loc6_strand->flip_strand;
598 $loc6_no_strand->flip_strand;
599 is $seq->subseq($loc6_strand), 'TTTTAAGGGGG';
600 is $seq->subseq($loc6_no_strand), 'TTTTAAGGGGG';
601 is $loc6_strand->to_FTstring, 'complement(join(6..10,19..20,1..4))';
602 is $loc6_no_strand->to_FTstring, 'complement(join(6..10,19..20,1..4))';
603 is $loc6_strand->length, 19;
604 is $loc6_no_strand->length, 19;
606 ## Trans-splicing, 2 sequences in different strands, 2nd in complement
607 #Coords: join(6..10,complement(16..20)) => CCCCCAAAAA
608 #Revcom: join(16..20,complement(6..10)) => TTTTTGGGGG
609 my $loc7_strand = Bio::Location::Split->new();
610 my $loc7_no_strand = Bio::Location::Split->new();
611 $loc7_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => 1) );
612 $loc7_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20, '-strand' => -1) );
613 $loc7_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10) );
614 $loc7_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20, '-strand' => -1) );
615 is $seq->subseq($loc7_strand), 'CCCCCAAAAA';
616 is $seq->subseq($loc7_no_strand), 'CCCCCAAAAA';
617 is $loc7_strand->to_FTstring, 'join(6..10,complement(16..20))';
618 is $loc7_no_strand->to_FTstring, 'join(6..10,complement(16..20))';
619 $loc7_strand->flip_strand;
620 $loc7_no_strand->flip_strand;
621 is $seq->subseq($loc7_strand), 'TTTTTGGGGG';
622 is $seq->subseq($loc7_no_strand), 'TTTTTGGGGG';
623 is $loc7_strand->to_FTstring, 'join(16..20,complement(6..10))';
624 is $loc7_no_strand->to_FTstring, 'join(16..20,complement(6..10))';
625 is $loc7_strand->length, 10;
626 is $loc7_no_strand->length, 10;
628 ## Trans-splicing, 2 sequences in different strands, 1st in complement
629 #Coords: join(complement(16..20),6..10) => AAAAACCCCC
630 #Revcom: join(complement(6..10),16..20) => GGGGGTTTTT
631 my $loc8_strand = Bio::Location::Split->new();
632 my $loc8_no_strand = Bio::Location::Split->new();
633 $loc8_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20, '-strand' => -1) );
634 $loc8_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => 1) );
635 $loc8_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 16, '-end' => 20, '-strand' => -1) );
636 $loc8_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10) );
637 is $seq->subseq($loc8_strand), 'AAAAACCCCC';
638 is $seq->subseq($loc8_no_strand), 'AAAAACCCCC';
639 is $loc8_strand->to_FTstring, 'join(complement(16..20),6..10)';
640 is $loc8_no_strand->to_FTstring, 'join(complement(16..20),6..10)';
641 $loc8_strand->flip_strand;
642 $loc8_no_strand->flip_strand;
643 is $seq->subseq($loc8_strand), 'GGGGGTTTTT';
644 is $seq->subseq($loc8_no_strand), 'GGGGGTTTTT';
645 is $loc8_strand->to_FTstring, 'join(complement(6..10),16..20)';
646 is $loc8_no_strand->to_FTstring, 'join(complement(6..10),16..20)';
647 is $loc8_strand->length, 10;
648 is $loc8_no_strand->length, 10;
650 ## Trans-splicing w/cut by origin, 2 sequences with 1st passing through origin, 2nd in complement
651 #Coords: join(19..20,1..3,complement(11..13)) => TTAAACCC
652 #Revcom: join(11..13,complement(1..3),complement(19..20)) => GGGTTTAA
653 my $loc9_strand = Bio::Location::Split->new();
654 my $loc9_no_strand = Bio::Location::Split->new();
655 $loc9_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20, '-strand' => 1) );
656 $loc9_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 3, '-strand' => 1) );
657 $loc9_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 11, '-end' => 13, '-strand' => -1) );
658 $loc9_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20) );
659 $loc9_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 3) );
660 $loc9_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 11, '-end' => 13, '-strand' => -1) );
661 is $seq->subseq($loc9_strand), 'TTAAACCC';
662 is $seq->subseq($loc9_no_strand), 'TTAAACCC';
663 is $loc9_strand->to_FTstring, 'join(19..20,1..3,complement(11..13))';
664 is $loc9_no_strand->to_FTstring, 'join(19..20,1..3,complement(11..13))';
665 $loc9_strand->flip_strand;
666 $loc9_no_strand->flip_strand;
667 is $seq->subseq($loc9_strand), 'GGGTTTAA';
668 is $seq->subseq($loc9_no_strand), 'GGGTTTAA';
669 is $loc9_strand->to_FTstring, 'join(11..13,complement(1..3),complement(19..20))';
670 is $loc9_no_strand->to_FTstring, 'join(11..13,complement(1..3),complement(19..20))';
671 is $loc9_strand->length, 8;
672 is $loc9_no_strand->length, 8;
674 ## Trans-splicing w/cut by origin, 2 sequences with 1st passing through origin, 1st in complement
675 #Coords: join(complement(1..3),complement(19..20),11..13) => TTTAAGGG
676 #Revcom: join(complement(11..13),19..20,1..3) => CCCTTAAA
677 my $loc10_strand = Bio::Location::Split->new();
678 my $loc10_no_strand = Bio::Location::Split->new();
679 $loc10_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 3, '-strand' => -1) );
680 $loc10_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20, '-strand' => -1) );
681 $loc10_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 11, '-end' => 13, '-strand' => 1) );
682 $loc10_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 3, '-strand' => -1) );
683 $loc10_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 19, '-end' => 20, '-strand' => -1) );
684 $loc10_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 11, '-end' => 13) );
685 is $seq->subseq($loc10_strand), 'TTTAAGGG';
686 is $seq->subseq($loc10_no_strand), 'TTTAAGGG';
687 is $loc10_strand->to_FTstring, 'join(complement(1..3),complement(19..20),11..13)';
688 is $loc10_no_strand->to_FTstring, 'join(complement(1..3),complement(19..20),11..13)';
689 $loc10_strand->flip_strand;
690 $loc10_no_strand->flip_strand;
691 is $seq->subseq($loc10_strand), 'CCCTTAAA';
692 is $seq->subseq($loc10_no_strand), 'CCCTTAAA';
693 is $loc10_strand->to_FTstring, 'join(complement(11..13),19..20,1..3)';
694 is $loc10_no_strand->to_FTstring, 'join(complement(11..13),19..20,1..3)';
695 is $loc10_strand->length, 8;
696 is $loc10_no_strand->length, 8;
698 ## Trans-splicing w/cut by origin, 2 sequences with 2nd passing through origin, 2nd in complement
699 #Coords: join(6..10,complement(1..2),complement(18..20)) => CCCCCTTAAA
700 #Revcom: join(18..20,1..2,complement(6..10)) => TTTAAGGGGG
701 my $loc11_strand = Bio::Location::Split->new();
702 my $loc11_no_strand = Bio::Location::Split->new();
703 $loc11_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => 1) );
704 $loc11_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2, '-strand' => -1) );
705 $loc11_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 18, '-end' => 20, '-strand' => -1) );
706 $loc11_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10) );
707 $loc11_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2, '-strand' => -1) );
708 $loc11_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 18, '-end' => 20, '-strand' => -1) );
709 is $seq->subseq($loc11_strand), 'CCCCCTTAAA';
710 is $seq->subseq($loc11_no_strand), 'CCCCCTTAAA';
711 is $loc11_strand->to_FTstring, 'join(6..10,complement(1..2),complement(18..20))';
712 is $loc11_no_strand->to_FTstring, 'join(6..10,complement(1..2),complement(18..20))';
713 $loc11_strand->flip_strand;
714 $loc11_no_strand->flip_strand;
715 is $seq->subseq($loc11_strand), 'TTTAAGGGGG';
716 is $seq->subseq($loc11_no_strand), 'TTTAAGGGGG';
717 is $loc11_strand->to_FTstring, 'join(18..20,1..2,complement(6..10))';
718 is $loc11_no_strand->to_FTstring, 'join(18..20,1..2,complement(6..10))';
719 is $loc11_strand->length, 10;
720 is $loc11_no_strand->length, 10;
722 ## Trans-splicing w/cut by origin, 2 sequences with 2nd passing through origin, 1st in complement
723 #Coords: join(complement(6..10),18..20,1..2) => GGGGGTTTAA
724 #Revcom: join(complement(1..2),complement(18..20),6..10) => TTAAACCCCC
725 my $loc12_strand = Bio::Location::Split->new();
726 my $loc12_no_strand = Bio::Location::Split->new();
727 $loc12_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => -1) );
728 $loc12_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 18, '-end' => 20, '-strand' => 1) );
729 $loc12_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2, '-strand' => 1) );
730 $loc12_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 6, '-end' => 10, '-strand' => -1) );
731 $loc12_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 18, '-end' => 20) );
732 $loc12_no_strand->add_sub_Location( Bio::Location::Simple->new('-start' => 1, '-end' => 2) );
733 is $seq->subseq($loc12_strand), 'GGGGGTTTAA';
734 is $seq->subseq($loc12_no_strand), 'GGGGGTTTAA';
735 is $loc12_strand->to_FTstring, 'join(complement(6..10),18..20,1..2)';
736 is $loc12_no_strand->to_FTstring, 'join(complement(6..10),18..20,1..2)';
737 $loc12_strand->flip_strand;
738 $loc12_no_strand->flip_strand;
739 is $seq->subseq($loc12_strand), 'TTAAACCCCC';
740 is $seq->subseq($loc12_no_strand), 'TTAAACCCCC';
741 is $loc12_strand->to_FTstring, 'join(complement(1..2),complement(18..20),6..10)';
742 is $loc12_no_strand->to_FTstring, 'join(complement(1..2),complement(18..20),6..10)';
743 is $loc12_strand->length, 10;
744 is $loc12_no_strand->length, 10;